FASTA sequence stream.
More...
#include <Sequence/Fasta.hpp>
|
| typedef std::string::iterator | iterator |
| |
| typedef std::string::const_iterator | const_iterator |
| |
|
typedef std::string::reference | reference |
| |
|
typedef std::string::const_reference | const_reference |
| |
|
typedef std::string::size_type | size_type |
| |
|
|
std::string | name |
| |
|
std::string | seq |
| |
FASTA sequence stream.
Publicly derived from Sequence::Seq, this class defines how to read and print sequences in FASTA format, which looks like:
>sequence name 1
ATGATGATCAGATAGACATAGCAGATACATGT
>sequence name 2
ATGTTGGTTTTTTTTTAGAGATGTTTATAGGT
ETC...
- Examples:
- codons.cc, and valid_dna.cc.
Definition at line 49 of file Fasta.hpp.
◆ const_iterator
Const iterator to sequence elements. Iterators access the data, not the sequence name. Value type de-references to char
Definition at line 83 of file Seq.hpp.
◆ iterator
Iterator to sequence elements. Iterators access the data, not the sequence name. Value type de-references to char
Definition at line 77 of file Seq.hpp.
◆ Fasta()
| Sequence::Fasta::Fasta |
( |
const Seq & |
seq | ) |
|
copy constructor
Definition at line 33 of file Fasta.cc.
◆ ~Fasta()
| Sequence::Fasta::~Fasta |
( |
| ) |
|
|
inline |
placeholder for vtable
Definition at line 59 of file Fasta.hpp.
◆ begin() [1/2]
- Returns
- an iterator to the beginning of the sequence
- Examples:
- valid_dna.cc.
Definition at line 189 of file Seq.cc.
◆ begin() [2/2]
- Returns
- a const iterator to the beginning of the sequence
Definition at line 207 of file Seq.cc.
◆ c_str()
| const char * Sequence::Seq::c_str |
( |
void |
| ) |
const |
|
inherited |
- Returns
- the the C-style string representing the sequence as a cont char *
Definition at line 243 of file Seq.cc.
◆ cbegin()
- Returns
- a const iterator to the beginning of the sequence
Definition at line 225 of file Seq.cc.
◆ cend()
- Returns
- a const iterator to the end of the sequence
Definition at line 234 of file Seq.cc.
◆ Complement()
| void Sequence::Seq::Complement |
( |
void |
| ) |
|
|
inherited |
Complement the Sequence
- Note
- This modifies the data in the object by changing the std::string–if you want to keep the original sequence, you need to make a copy of the object first.
Definition at line 163 of file Seq.cc.
◆ end() [1/2]
- Returns
- an iterator to the end of the sequence
- Examples:
- valid_dna.cc.
Definition at line 198 of file Seq.cc.
◆ end() [2/2]
- Returns
- a const iterator to the end of the sequence
Definition at line 216 of file Seq.cc.
◆ GetName()
| std::string Sequence::Seq::GetName |
( |
void |
| ) |
const |
|
inherited |
◆ GetSeq()
| std::string Sequence::Seq::GetSeq |
( |
void |
| ) |
const |
|
inherited |
◆ IsGapped()
| bool Sequence::Seq::IsGapped |
( |
void |
| ) |
const |
|
inherited |
Returns 1 if the sequence contaings the gap character '-', 0 otherwise
Definition at line 137 of file Seq.cc.
◆ length()
| Seq::size_type Sequence::Seq::length |
( |
void |
| ) |
const |
|
inherited |
Return the total length of the sequence in bytes
- Examples:
- codons.cc.
Definition at line 58 of file Seq.cc.
◆ operator std::string()
| Sequence::Seq::operator std::string |
( |
| ) |
const |
|
inherited |
allows (implict) cast to std::string
Definition at line 117 of file Seq.cc.
◆ operator!=()
| bool Sequence::Seq::operator!= |
( |
const Seq & |
rhs | ) |
const |
|
inherited |
- Returns
- false if the sequences contain the same data, true otherwise.
- Note
- only the sequences (i.e. this->seq and rhs.seq) are compared
Definition at line 107 of file Seq.cc.
◆ operator==()
| bool Sequence::Seq::operator== |
( |
const Seq & |
rhs | ) |
const |
|
inherited |
- Returns
- true if the sequences contain the same data, false otherwise.
- Note
- only the sequences (i.e. this->seq and rhs.seq) are compared
Definition at line 96 of file Seq.cc.
◆ operator[]() [1/2]
| Seq::reference Sequence::Seq::operator[] |
( |
const size_type & |
i | ) |
|
|
inherited |
Return the i-th element of the sequence.
- Note
- range-checking is done by assert()
Definition at line 75 of file Seq.cc.
◆ operator[]() [2/2]
| Seq::const_reference Sequence::Seq::operator[] |
( |
const size_type & |
i | ) |
const |
|
inherited |
Return the i-th element of the sequence.
- Note
- range-checking is done by assert()
Definition at line 85 of file Seq.cc.
◆ print()
| std::ostream & Sequence::Fasta::print |
( |
std::ostream & |
s | ) |
const |
|
virtual |
- Parameters
-
| stream | a std::ostream write the sequence in FASTA format to stream |
Implements Sequence::Seq.
Definition at line 66 of file Fasta.cc.
◆ read()
| std::istream & Sequence::Fasta::read |
( |
std::istream & |
s | ) |
|
|
virtual |
- Exceptions
-
| Sequence::SeqException | if memory can't be allocated. (This is because the data are temporarily read into char *, because that was found to be faster). |
| Sequence::badFormat | if the input stream is not in FASTA format |
Implements Sequence::Seq.
Definition at line 41 of file Fasta.cc.
◆ Revcom()
| void Sequence::Seq::Revcom |
( |
void |
| ) |
|
|
inherited |
Reverse and complement the sequence.
- Note
- This function modifies the data in the object by changing the std::string–if you want to keep the original sequence, you need to make a copy of the object first.
- Returns
- *this
Definition at line 175 of file Seq.cc.
◆ size()
| Seq::size_type Sequence::Seq::size |
( |
void |
| ) |
const |
|
inherited |
Return the total length of the sequence in bytes
Definition at line 67 of file Seq.cc.
◆ Subseq()
| void Sequence::Seq::Subseq |
( |
const unsigned & |
beg, |
|
|
const unsigned & |
length |
|
) |
| |
|
inherited |
- Parameters
-
| beg | the index along the sequence at which the substring begins |
| length | the length of the subseq Acts via std::string.substr(). Note that this modifies the data in the object by changing thestd::string–if you want to keep the original sequence, you need to make a copy of the object first. |
- Note
- range-checking done by assert()
Definition at line 147 of file Seq.cc.
◆ substr() [1/2]
| std::string Sequence::Seq::substr |
( |
std::string::size_type |
beg, |
|
|
std::string::size_type |
len |
|
) |
| const |
|
inherited |
- Deprecated:
- access .second.substr directly
Mimics the std::string member function of the same name.
Definition at line 40 of file Seq.cc.
◆ substr() [2/2]
| std::string Sequence::Seq::substr |
( |
std::string::size_type |
beg | ) |
const |
|
inherited |
- Deprecated:
- access .second.substr directly
Mimics the standardstd::string member function of the same name.
Definition at line 49 of file Seq.cc.
◆ UngappedLength()
| Seq::size_type Sequence::Seq::UngappedLength |
( |
void |
| ) |
const |
|
inherited |
Return length of sequence, excluding the gap character '-'
Definition at line 126 of file Seq.cc.
The documentation for this class was generated from the following files: